Hoja de vida

Categoría Investigador Junior (IJ) con vigencia hasta la publicación de los resultados de la siguiente convocatoria
Nombre Blanca Lisseth Guzman Barragan
Nacionalidad Colombiana
Sexo Femenino

Formación Académica

  • Doctorado Universidade Federal De Viçosa
    Departamento de Medicina Veterinária
    Juliode2009 - Octubrede 2013
  • Maestría/Magister Universidade Federal De Viçosa
    Departamento de Medicina Veterinaria
    Enerode2008 - de 2010
  • Pregrado/Universitario UNIVERSIDAD DEL TOLIMA
    Medicina Veterinária y Zootecnia
    Juliode2002 - Diciembrede 2007

    Formación Complementaria

  • Cursos de corta duración INSTITUTO NACIONAL DE SALUD
    Grupo de Saude Ambiental
    Juniode2012 - Juniode 2012
  • Cursos de corta duración Escola Nacional de Saude Publica Serguio Arouca/ Fiocruz
    Escola Nacional de Saude Publica Sergio Arouca
    Juliode2011 - Agostode 2011
  • Cursos de corta duración Universidade Federal De Viçosa
    Departamento de Medicina Veterinaria
    Abrilde2007 - Mayode 2007
  • Cursos de corta duración UNIVERSIDAD NACIONAL DE COLOMBIA
    Departamento de Matemáticas
    Febrerode2002 - Abrilde 2002
  • Cursos de corta duración Universidade Federal De Viçosa
    Departamento de Medicina Veterinaria
    Mayode2007 - Diciembrede 2007
  • Cursos de corta duración Universidade Federal De Viçosa
    Departamento de Medicina Veterinaria
    Abrilde2007 - Mayode 2007

    Experiencia profesional

    Dedicación: 40 horas Semanales Julio de 2019 de

  • Universidade Federal De Viçosa
    Dedicación: 40 horas Semanales Agosto de 2009 de Actual

    Actividades de investigación
    -   Pasantías - Titulo:  Evaluación del desempeño del sistema nacional de vigilancia en salud ambiental relacionada a la calidad del agua para consumo humano de Colombia: Estudio de casos multicentrico con múltiplos niveles de análisis Agosto 2013
  • Secretaria De Salud Municipal De Ibague
    Dedicación: 40 horas Semanales Octubre de 2016 Diciembre de 2019

    Dedicación: 10 horas Semanales Febrero de 2017 Junio de 2019

    Dedicación: 40 horas Semanales Enero de 2013 Diciembre de 2016

    Dedicación: 20 horas Semanales Agosto de 2015 Diciembre de 2015

    Dedicación: 4 horas Semanales Abril de 2008 de 2012

    Actividades de investigación
    -   Investigación y Desarrollo - Titulo:  Estado de la Vigilancia de la calidad de agua para consumo humano en Colombia, 2007 - 2011 Mayo 2009
  • Organización Panamericana De La Salud.
    Dedicación: 6 horas Semanales Junio de 2012 Noviembre de 2012

    Actividades de investigación
    -   Investigación y Desarrollo - Titulo:  Análisis descriptivo y espacial de la calidad de agua para consumo humano en Colombia a partir del índice de riesgo de la calidad de agua (IRCA) y su relación con factores ambientales y procesos mórbidos en salud, 2007 - 20011 Junio 2012 Noviembre 2012
  • Universidade Federal De Viçosa
    Dedicación: 4 horas Semanales Febrero de 2011 Junio de 2011

    Actividades de docencia
    -   Pregrado - Nombre del curso:  Saneamiento, 50 Febrero 2011 Junio 2011
  • Universidade Federal De Viçosa
    Dedicación: 40 horas Semanales Febrero de 2008 Julio de 2009

    Actividades de investigación
    -   Investigación y Desarrollo - Titulo:  Sistemas Nacionales de Vigilancia de la calidad da agua para consumo humano: Estudio comparativo Brasil e Colombia Febrero 2008 Julio 2009
  • Universidade Federal De Viçosa
    Dedicación: 20 horas Semanales Marzo de 2007 Diciembre de 2008

    Actividades de investigación
    -   Investigación y Desarrollo - Titulo:  Avaliação de sistemas da wetlands construídos para o tratamento de esgotos sanitários e produção de biomassa para alimentação animal Agosto 2007 Diciembre 2008
  • Universidade Federal De Viçosa
    Dedicación: 4 horas Semanales Marzo de 2007 Diciembre de 2008

    Actividades de investigación
    -   Investigación y Desarrollo - Titulo:  Programa nacional de vigilância ambiental em saúde relacionada à qualidade da água para consumo humano: implementação e avaliação no município de Viçosa-Minas Gerais. Marzo 2007 Diciembre 2008
  • Universidade Federal De Viçosa
    Dedicación: 4 horas Semanales Febrero de 2008 Junio de 2008

    Actividades de docencia
    -   Pregrado - Nombre del curso:  Epidemiología, 50 Febrero 2008 Junio 2008
  • Secretaria de Saude Municipal de Viçosa - Vigilancia Epidemiologíca
    Dedicación: 4 horas Semanales Marzo de 2007 Diciembre de 2007

    Actividades de investigación
    -   Pasantías - Titulo:  Elaboração de bancos de datos de accidentes com animais peçonhetos Marzo 2007 Diciembre 2007

    Áreas de actuación

  •  Ciencias Médicas y de la Salud -- Ciencias de la Salud -- Epidemiología
  •  Ciencias Agrícolas -- Ciencias Veterinarias -- Ciencias Veterinarias
  •  Ciencias Médicas y de la Salud -- Ciencias de la Salud -- Salud Pública
  • Idiomas

      Habla Escribe Lee Entiende
  •  Portugués
  • Bueno Bueno Bueno Bueno
  •  Inglés
  • Aceptable Deficiente Bueno Aceptable
  •  Español
  • Bueno Bueno Bueno Bueno

    Líneas de investigación

  •  Salud Ambiental, Activa:Si
  •  Salud Pública, Activa:Si
  •  Sistemas de Vigilancia en salud, Activa:Si
  •  Calidad del Agua, Activa:Si
  •  Evaluación en Salud, Activa:Si
  •  Epidemiología, Activa:Si
  •  Zoonosis, Activa:Si
    Los ítems de producción con la marca corresponden a productos avalados y validados para la última Convocatoria Nacional para el Reconocimiento y Medición de Grupos de Investigación, Desarrollo Tecnológico o de Innovación y para el Reconocimiento de Investigadores del SNCTeI

    Cursos de corta duración

  • Producción técnica - Cursos de corta duración dictados - Extensión extracurricular
  • BLANCA LISSETH GUZMAN BARRAGAN, ONE HEALTH IN LATINOAMERICA BRASIL - COLOMBIA, Finalidad: Se realizó una seminario en conjunto con la universidad UNOESC de Brasil sobre ONE HEALTH IN LATINOAMERICA BRASIL - COLOMBIA . En: Colombia  ,2019,  ,UNIVERSIDAD DE CIENCIAS APLICADAS Y AMBIENTALES U.D.C.A.  participación: Docente , 56 semanas 

    Trabajos dirigidos/tutorías

  • Trabajos dirigidos/Tutorías - Trabajos de grado de pregrado
  • Trabajos dirigidos/Tutorías - Trabajos de grado de pregrado
  • BLANCA LISSETH GUZMAN BARRAGAN, Análisis de la casuística equina del Centro de Perinatología Equina Foal Care en Cajicá  UNIVERSIDAD DE CIENCIAS APLICADAS Y AMBIENTALES U.D.C.A  Estado: Tesis concluida  Medicina Veterinaria,  2019. Dirigió como: ,   Persona(s) orientada(s):    Asesor(es): BLANCA LISSETH GUZMAN BARRAGAN,
  • Trabajos dirigidos/Tutorías - Trabajos de grado de pregrado

    Jurado en comités de evaluación

  • Datos complementarios - Jurado/Comisiones evaluadoras de trabajo de grado - Maestría

    Eventos científicos

    1 Nombre del evento: Workshop, Uso e reuso de água salinas e residuais  Tipo de evento: Otro  Ámbito:   Realizado el:,    en Vicosa   - Viçosa  
    Instituciones asociadas
    • Nombre de la institución:Universidade Federal De Viçosa Tipo de vinculaciónPatrocinadora
    • Nombre: BLANCA LISSETH GUZMAN BARRAGAN Rol en el evento: Organizador
    2 Nombre del evento: Semana da Pós Graduação em Medicina Veterinária  Tipo de evento: Otro  Ámbito: Nacional  Realizado el:2008-01-01 00:00:00.0,    en Vicosa   -  
    Instituciones asociadas
    • Nombre de la institución:Universidade Federal De Viçosa Tipo de vinculaciónPatrocinadora
    • Nombre: BLANCA LISSETH GUZMAN BARRAGAN Rol en el evento: Organizador
    3 Nombre del evento: X Congreso Español y I Iberoamericano de Sanidad Ambiental "La Innovación instrumento para la Sanidad Ambienta"  Tipo de evento: Congreso  Ámbito: Nacional  Realizado el:2009-01-01 00:00:00.0,    en La Coruña   -  
    Instituciones asociadas
    • Nombre de la institución:Sociedad Española de Sanidad Ambiental Tipo de vinculaciónPatrocinadora
    • Nombre: BLANCA LISSETH GUZMAN BARRAGAN Rol en el evento: Organizador
    4 Nombre del evento: VII Congresso Brasileiro de Epidemiologia "Epidemiologia e Políticas de Saúde  Tipo de evento: Congreso  Ámbito: Nacional  Realizado el:2011-01-01 00:00:00.0,    en São Paulo   -  
    Instituciones asociadas
    • Nombre de la institución:Ministério Da Saúde Tipo de vinculaciónPatrocinadora
    • Nombre: BLANCA LISSETH GUZMAN BARRAGAN Rol en el evento: Organizador
    5 Nombre del evento: Semana de Pós- Graduação em Medicina Veterinária.  Tipo de evento: Otro  Ámbito:   Realizado el:2008-01-01 00:00:00.0,    en   -  
    Productos asociados
    • Nombre del producto:Atuação da vigilância da qualidade da água para consumo humano: estudo comparativo entre o Brasil e a Colômbia. Tipo de producto:Producción bibliográfica - Trabajos en eventos (Capítulos de memoria) - Completo
    • Nombre: BLANCA LISSETH GUZMAN BARRAGAN Rol en el evento: Asistente
    6 Nombre del evento: X Congreso Español y II beroamericano de Sanidad Ambiental "La Innovación instrumento para la Sanidad Ambiental  Tipo de evento: Congreso  Ámbito:   Realizado el:2009-10-01 00:00:00.0,    en   -  
    Productos asociados
    • Nombre del producto:Análisis comparativo de las estrategias operativas empleadas en los sistemas nacionales de VQACH de Brasil y Colombia Tipo de producto:Producción bibliográfica - Trabajos en eventos (Capítulos de memoria) - Resumen
    • Nombre: BLANCA LISSETH GUZMAN BARRAGAN Rol en el evento: Asistente
    7 Nombre del evento: VII Congresso brasileiro de epidemiologia Epidemiologia e politicas de saúde publica de saúde  Tipo de evento: Congreso  Ámbito:   Realizado el:2011-11-01 00:00:00.0,    en São Paulo   -  
    Productos asociados
    • Nombre del producto:Analises das políticas de vigilância da qualidade da água para consumo humano do Brasil e Colombia Tipo de producto:Producción bibliográfica - Trabajos en eventos (Capítulos de memoria) - Resumen
    • Nombre: BLANCA LISSETH GUZMAN BARRAGAN Rol en el evento: Asistente


  • Producción bibliográfica - Artículo - Publicado en revista especializada
  • GERARDO NAVA TOVAR, BLANCA LISSETH GUZMAN BARRAGAN, PAULA DIAZ BEVILACQUA, "Contextos locales de vigilancia de la calidad del agua para consumo humano: Brasil y Colombia" . En: Colombia 
    Revista de Salud Pública  ISSN: 0124-0064  ed: Instituto de Estudios Políticos y Relaciones Internacionales de la Universidad Nacional de Colombia
    v.17 fasc.6 p.961 - 972 ,2015,  DOI: DOI: http://dx.doi.org/10.15446/rsap.v17n6.40977
    Calidad de Agua, Salud Ambiental, Salud Pública, Vigilancia de la Calidad del Agua, Vigilancia en Salud Ambiental,
  • Producción bibliográfica - Artículo - Publicado en revista especializada
  • BLANCA LISSETH GUZMAN BARRAGAN, DIOSELINA PELAEZ CARVAJAL, GERARDO NAVA TOVAR, "Presencia de virus entéricos en muestras de agua para consumo en Colombia: desafíos para los sistemas de abastecimiento." . En: Colombia 
    Biomedica  ISSN: 0120-4157  ed: Instituto Nacional de Salud
    v.36 fasc. p.2344 - 2360 ,2016,  DOI: DOI: http://dx.doi.org/10.7705/biomedica.v36i0.2987
    Calidad de Agua, Salud Ambiental, Vigilancia en Salud Ambiental, virologia,
  • Producción bibliográfica - Artículo - Publicado en revista especializada
  • BLANCA LISSETH GUZMAN BARRAGAN, PAULA DIAZ BEVILACQUA, GERARDO NAVA TOVAR, "La calidad del agua para consumo humano y su asociación con la morbimortalidad en Colombia, 2008-2012." . En: Colombia 
    Biomedica  ISSN: 0120-4157  ed: Instituto Nacional de Salud
    v.35 fasc.2 p.177 - 190 ,2015,  DOI: doi: http://dx.doi.org/10.7705/biomedica.v35i0.2511
    Calidad de Agua, Salud Ambiental, Salud Pública, Vigilancia de la Calidad del Agua, Vigilancia en Salud Ambiental,
  • Producción bibliográfica - Artículo - Caso clínico
  • BLANCA LISSETH GUZMAN BARRAGAN, "Brote inusitado de leishmaniasis cutánea en zona rural de Ibagué: desafíos de la notificación" . En: Colombia 
    Revista U.D.C.A. Actualidad & Divulgación Científica  ISSN: 0123-4226  ed: Ediudca
    v.24 fasc.| p.1 - 5 ,2021,  DOI: 10.31910/rudca.v24.n1.2021.1502
  • Producción bibliográfica - Artículo - Publicado en revista especializada
  • BLANCA LISSETH GUZMAN BARRAGAN, GERARDO NAVA TOVAR, PAULA DIAZ BEVILACQUA, "Vigilância da qualidade da água para consumo humano: avaliando o grau de implementação das ações." . En: Brasil 
    Ciencia '&' Saude Coletiva  ISSN: 1678-4561  ed: Associacao Brasileira De Saude Coletiva Abrasco
    v.19 fasc.10 p.4163 - 4180 ,2014,  DOI: DOI: 10.1590/1413-812320141910.09452014
    Salud Pública, Calidad de Agua, Salud Ambiental, Vigilancia de la Calidad del Agua, Vigilancia en Salud Ambiental,
  • Producción bibliográfica - Artículo - Publicado en revista especializada
  • BLANCA LISSETH GUZMAN BARRAGAN, "Toxoplasma gondii in small ruminants in northeastern areas of Colombia: Seroprevalence and risk factors" . En:  
    Parasite Epidemiology and Control  ISSN: 2405-6731  ed: Elsevier Limited
    v.10 fasc. p.1 - 8 ,2020,  DOI: 10.1016/j.parepi.2020.e00147
  • Producción bibliográfica - Artículo - Publicado en revista especializada
    Hacia La Promocion De La Salud  ISSN: 2462-8425  ed: Forec Universidad De Caldas
    v.25 fasc.1 p.76 - 89 ,2020,  DOI: 10.17151/hpsal.2020.25.1.6
  • Producción bibliográfica - Artículo - Publicado en revista especializada
  • BLANCA LISSETH GUZMAN BARRAGAN, "Presence of pesticides, mercury and trihalomethanes in the water supply systems of Ibagué, Colombia: threats to human health" . En:  
    Revista Ambiente e Agua  ISSN: 1980-993X  ed: Instituto de Pesquisas Ambientais em Bacias Hidrograficas (IPABHi)
    v.15 fasc. p.1 - 11 ,2020,  DOI: 10.4136/ambi-agua.2477
  • Producción bibliográfica - Artículo - Publicado en revista especializada
  • BLANCA LISSETH GUZMAN BARRAGAN, NOEL VERJAN GARCIA, "Prevalencia de anticuerpos anti-Leptospira spp. en personas con exposición laboral en el departamento del Tolima" . En: Colombia 
    Revista Facultad Nacional De Salud Pública  ISSN: 0120-386X  ed: Editorial Universidad de Antioquia
    v.34 fasc.2 p.156 - 166 ,2016,  DOI: http://dx.doi.org/10.17533/udea.rfnsp.v34n2a04.
    Salud Ambiental, Salud Pública, Zoonosis, Leptospirosis,
  • Producción bibliográfica - Artículo - Publicado en revista especializada
  • BLANCA LISSETH GUZMAN BARRAGAN, GERARDO NAVA TOVAR, PAULA DIAZ BEVILACQUA, "Vigilancia de la calidad del agua para consumo humano en Colombia: desafíos para la salud ambiental" . En: Colombia 
    Revista Facultad Nacional De Salud Pública  ISSN: 0120-386X  ed: Editorial Universidad de Antioquia
    v.34 fasc.2 p.175 - 183 ,2016,  DOI: http://dx. doi. org/10.17533/udea. rfnsp. v34n2a06.
    Calidad de Agua, Salud Pública, Salud Ambiental, Vigilancia de la Calidad del Agua,


  • Producción bibliográfica - Libro - Otro libro publicado
  • BLANCA LISSETH GUZMAN BARRAGAN, "Estado de la Vigilancia de la calidad de agua para consumo humano en Colombia, 2007 - 2011" En: Colombia 2013.  ed:Instituo Nacional De Salud  ISBN: 2322-9497  v. 0 pags. 580
    Salud Pública, Salud Ambiental, Calidad de Agua, Vigilancia de la Calidad del Agua, Vigilancia en Salud Ambiental,
    Ciencias Médicas y de la Salud -- Ciencias de la Salud -- Salud Pública, Ciencias Naturales -- Ciencias de la Tierra y Medioambientales -- Oceanografía, Hidrología y Recursos del Agua,
  • Producción bibliográfica - Libro - Otro libro publicado
  • BLANCA LISSETH GUZMAN BARRAGAN, "Segundo Informe sobre el Estado de la vigilancia de la calidad de agua para consumo humano en Colombia" En: Colombia 2014.  ed:Instituto Nacional de Salud  ISBN: 23229497  v. pags. 
    Salud Pública, Salud Ambiental, Calidad de Agua, Vigilancia en Salud Ambiental, Vigilancia de la Calidad del Agua,
    Ciencias Médicas y de la Salud -- Ciencias de la Salud -- Salud Pública, Ciencias Naturales -- Ciencias de la Tierra y Medioambientales -- Oceanografía, Hidrología y Recursos del Agua,

    Protocolos de vigilancia epidemiológica

    Producción técnica - Protocolo de vigilancia epidemiológica
    Producción técnica - Protocolo de vigilancia epidemiológica
    Producción técnica - Protocolo de vigilancia epidemiológica
    BLANCA LISSETH GUZMAN BARRAGAN, Enfermedades vehiculizadas por agua-EVA e índice de riesgo de la calidad en Colombia-IRCA, 2008 - 2013, En: Noviembre - 2013 . En: BOGOTÁ, D.C..  Institución: INSTITUTO NACIONAL DE SALUD 
    Producción técnica - Protocolo de vigilancia epidemiológica
    Producción técnica - Protocolo de vigilancia epidemiológica
    Producción técnica - Protocolo de vigilancia epidemiológica
    BLANCA LISSETH GUZMAN BARRAGAN, Estado de la Vigilancia de la Calidad del Agua para Consumo Humano en Colombia - 2013, En: Noviembre - 2013 . En: BOGOTÁ, D.C..  Institución: INSTITUTO NACIONAL DE SALUD 
    Producción técnica - Protocolo de vigilancia epidemiológica
    Producción técnica - Protocolo de vigilancia epidemiológica
    Producción técnica - Protocolo de vigilancia epidemiológica
    Producción técnica - Protocolo de vigilancia epidemiológica
    Producción técnica - Protocolo de vigilancia epidemiológica
    BLANCA LISSETH GUZMAN BARRAGAN, Enfermedades Vehiculizadas por Agua-EVA e Índice de Riesgo de la Calidad-IRCA. Colombia 2014, En: Enero - 2014 . En: BOGOTÁ, D.C..  Institución: INSTITUTO NACIONAL DE SALUD 

    Normas y Regulaciones

  • Producción técnica - Regulación, norma, reglamento o legislación - Acto legislativo
  • BLANCA LISSETH GUZMAN BARRAGAN, Decreto 1000 -0502 de 2017 - Por medio del cual se crea el Consejo Territorial de Salud Ambiental - COTSA, en Ibagué y se dictan otras dispocisiones, Nombre comercial: , contrato/registro: , . En: Colombia,  ,2017,  .ed:   meses   p.  .regulación:   .tipo:  

    Eventos artísticos

    Nombre del evento: I jornada de la lengua española  Fecha de inicio: 2010-10-26 00:00:00.0 
    Tipo del evento:  


    Tipo de proyecto: Investigación y desarrollo 
    Inicio: Febrero  2021 Duración 

    La Leptospirosis es una enfermedad zoonosis de gran impacto para la salud pública, es considerada una de las enfermedades re-emergentes más importantes a nivel mundial. La enfermedad es causada por una bacteria del genereo leptospira spp., Gram-negativa transmitida al humano principalmente por el contacto directo con roedores y caninos, o el contacto indirecto a través del consumo de agua y de fuentes hídricas contaminadas con la orina de dichos animales. El presente tiene como objetivo determinar la prevalencia de la leptospirosis en caninos de la ciudad de Bogotá DC e identificar potenciales factores de riesgo para la presentación y permanencia de la enfermedad. Se implementarán técnicas serológicas para el diagnóstico de la leptospira spp y técnicas moleculares de PCR convencional y PCR múltiple a fin de compararlas y determinar su utilidad como herramientas diagnósticas complementarias de la enfermedad. El estudio se realizará en la ciudad de Bogotá DC, la población de estudio se estimó siguiendo los postulados de Thrusfield (2007) con un nivel de confianza del 95%, una precisión o error del 5% y una prevalencia esperada del 21.4 % basado en un estudio previo en otros municipios del Tolima (Romero y Sánchez, 2009). Se tomaran muestras de sangre de 5 ml mediante punción de la vena cefálica o yugular y 10 ml de orina por sondaje uretral, las muestras serán transportadas y procesadas en el laboratorio de diagnóstico molecular UDCA. El diagnostico serológico se realizará mediante ensayo de ELISA para la detección de anticuerpos clase IgM y test de MAT. Para el diagnóstico molecular se realizada la extracción de ADN bacteriano el kit QIAamp DNA mini kit (QIAGEN, Germany), la reacción de PCR se llevará a cabo mediante los primers LipL32/270F (CGCTGAAATGGGAGTTCGTATGATT) y LipL32/692R (CCAACAGATGCAACGAAAGATCCTTT) descritos por Levett et al (2005). simultáneamente se aplicara una encuesta epidemiologica para identificar potenciales factores de riesgos asociados a la leptospirosis., los cuales será determinados través del cálculo de Odds Ratio probado estadísticamente mediante X2 considerando intervalos de confianza con un nivel de significancia del 95% y los p< 0,05.